SubtiBank SubtiBank
frlO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

frlO

aminosugar [SW|ABC transporter] (binding protein)
locus
BSU32600
pI
5.67
mw
47.86 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
uptake of sugar amines
product
aminosugar [SW|ABC transporter] (binding protein)
essential
no
synonyms
yurO

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.17|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.3|Utilization of amino sugars]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,349,761 3,351,029

    The protein

    Protein family

  • [SW|Bacterial solute-binding protein 1 family] (according to UniProt)
  • Structure

  • [PDB|3ZKK] (from Bifidobacterium animalis, 26% identity) [pubmed|24279727]
  • [SW|Localization]

  • membrane associated (via [protein|1F245030D0C81DC96FC0642199CA00579CF46D06|FrlM]-[protein|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|FrlN]) [Pubmed|10092453,18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|yurJ]
    description
    [Pubmed|23175651,21347729,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455], [pubmed|18083814], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR]: repression, [Pubmed|21398478], in [regulon|412A1DBBE7F87765DEBEEAAE02A047636A354D5E|FrlR regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • '' [protein|C87E74FB67B53DD1C68916AA121388C60CE66E92|FrlB]'': repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • additional information

  • the [gene|C87E74FB67B53DD1C68916AA121388C60CE66E92|frlB]-[gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]-[gene|8256CAAEC591E40A8CB172FF053E03BFFD5A4B54|frlN]-[gene|1F245030D0C81DC96FC0642199CA00579CF46D06|frlM]-[gene|C3823AFED3E5C3D1EA04C38D861239468C9E6349|frlD]-[gene|3B9331D6755B8253944AB33521BBF2B3EBA4CAEB|yurJ] operon is strongly downregulated in a [gene|search|cshA ]mutant [Pubmed|23175651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A561 (yurO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/561 NBRP B. subtilis, Japan]
  • BKE32600 ([gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTGGCCTCCTCTG, downstream forward: _UP4_TAAATCAAAGAAAAGGTGAA
  • BKK32600 ([gene|9E3FF9D0B33D7EFEA3B61FF863BB46CC6DFD4F9B|frlO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGGGTTGGCCTCCTCTG, downstream forward: _UP4_TAAATCAAAGAAAAGGTGAA
  • References

  • 23175651,21815947,12618455,10092453,21347729,18763711,21398478,24279727