SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


small acid-soluble spore protein (minor alpha/beta-type SASP)
7.62 kDa
protein length
gene length
219 bp Sequence Blast
protection of spore DNA
small acid-soluble spore protein (minor alpha/beta-type SASP)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Small acid-soluble spore proteins]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,156,239 2,156,457

    The protein

    Protein family

  • [SW|Alpha/beta-type SASP family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|SspD], [protein|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|SspA], [protein|28F47ADECD376494878AE58B395B3A2616B6B5DF|SspB]
  • Structure

  • [PDB|2Z3X] (in complex with DNA)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,2468649], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,2468649]
  • view in new tab

    Biological materials


  • BKE19950 ([gene|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCATCTCCTAAA, downstream forward: _UP4_TTAGCTCAACAAAACATGGGC
  • BKK19950 ([gene|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|sspC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCATCTCCTAAA, downstream forward: _UP4_TTAGCTCAACAAAACATGGGC
  • References

  • 14526021,11044450,11274127,15150240,8071212,12234173,9573155,2981806,2468649,18287075,15699190