SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


NADPH-flavin nitroreductase
25.48 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
protection against NaOCl stress
NADPH-flavin nitroreductase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.4|Electron transport/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    854,412 855,077

    Phenotypes of a mutant

  • a ''[gene|9DF5999568760E016ECA988385A1FA61A257D486|hypO] [gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]'' mutant is more sensitive to NaOCl stress than ''[gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]'' single mutant [Pubmed|22238377]
  • The protein

    Catalyzed reaction/ biological activity

  • reduction of 2,6-dinitrotoluene [pubmed|31392514]
  • Protein family

  • [SW|nitroreductase family] (according to UniProt)
  • [SW|Cofactors]

  • FMN [Pubmed|21635694] (according to UniProt)
  • NADP [pubmed|31392514]
  • Structure

  • [PDB|2H0U] (from Helicobacter pylori, 45% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22238377], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR]: activation, [Pubmed|22238377], in [regulon|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR regulon]
  • regulation

  • induced under disulfide stress conditions (diamide, NaOCl) ([protein|search|HypR]) [Pubmed|22238377]
  • view in new tab

    Biological materials


  • MGNA-C366 (yfkO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07830 ([gene|9DF5999568760E016ECA988385A1FA61A257D486|hypO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACACCTCTCCTT, downstream forward: _UP4_TAAAAGAAGAAAGCTGCTCG
  • BKK07830 ([gene|9DF5999568760E016ECA988385A1FA61A257D486|hypO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACACCTCTCCTT, downstream forward: _UP4_TAAAAGAAGAAAGCTGCTCG
  • labs

  • [SW|Haike Antelmann], University of Greifswald, Germany
  • References

    Original publications

  • 20727918,31392514