SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


47.12 kDa
protein length
429 aa Sequence Blast
gene length
1290 bp Sequence Blast
galactan utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of galactan]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,501,651 3,502,940

    Phenotypes of a mutant

  • a ''[gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]-[gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]-[gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]-[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]-[gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]'' mutant is impaired in the utilization of galactan [Pubmed|22893383]
  • The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of (14)-beta-D-galactosidic linkages in galactan, generation of galactotriose [Pubmed|22893383]
  • Protein family

  • glycosyl hydrolase 53 family (single member, according to UniProt)
  • Structure

  • [PDB|2J74] (B. licheniformis)
  • [SW|Localization]

  • likely to be extracellular, carries a predicted a signal peptide of 26 amino acid residues at the N-terminus [Pubmed|27501980,22893383]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|27501980], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]: repression, [Pubmed|9287030], in [regulon|1F787F70C87DEB221709579122D63C2322A84E56|GanR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|28617843], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galactan (binding of galactobiose to [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]) [Pubmed|28617843,27501980]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|28617843,27501980]
  • view in new tab

    Biological materials


  • MGNA-A487 (yvfO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34120 ([gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCATCCCCCCAAG, downstream forward: _UP4_TGAAACAAAAAAATCCATGA
  • BKK34120 ([gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCATCCCCCCAAG, downstream forward: _UP4_TGAAACAAAAAAATCCATGA
  • References

  • 17056685,9287030,22893383,27501980