SubtiBank SubtiBank
yqiG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqiG

similar to NADH-dependent flavin oxidoreductase
locus
BSU_24210
pI
5.18
mw
40.65 kDa
protein length
372 aa Sequence Blast
gene length
1119 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,516,440 2,517,558

    The protein

    Protein family

  • NADH:flavin oxidoreductase/NADH oxidase family (with [protein|EB17629B7598C62741072E1AF0AB715C02041B70|YqjM], according to UniProt)
  • Paralogous protein(s)

  • [protein|EB17629B7598C62741072E1AF0AB715C02041B70|YqjM]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3L5A] (from Staphylococcus aureus, 30% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|yqiG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C370 (yqiG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2368 NBRP B. subtilis, Japan]
  • BKE24210 ([gene|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|yqiG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCATCTTCTTTCG, downstream forward: _UP4_TAATGTGCAAAGACTGCCGA
  • BKK24210 ([gene|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|yqiG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCATCTTCTTTCG, downstream forward: _UP4_TAATGTGCAAAGACTGCCGA
  • References

  • 22383849