SubtiBank SubtiBank
yqiG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqiG

similar to NADH-dependent flavin oxidoreductase
locus
BSU24210
pI
5.18
mw
40.65 kDa
protein length
372 aa Sequence Blast
gene length
1119 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,516,440 2,517,558

    The protein

    Protein family

  • NADH:flavin oxidoreductase/NADH oxidase family (according to UniProt) (with [protein|EB17629B7598C62741072E1AF0AB715C02041B70|YqjM])
  • Paralogous protein(s)

  • [protein|EB17629B7598C62741072E1AF0AB715C02041B70|YqjM]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3L5A] (from Staphylococcus aureus, 30% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|yqiG]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C370 (yqiG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2368 NBRP B. subtilis, Japan]
  • BKE24210 ([gene|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|yqiG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCATCTTCTTTCG, downstream forward: _UP4_TAATGTGCAAAGACTGCCGA
  • BKK24210 ([gene|9DC6FD87D1AF7CD2F41738E04C4D6DCD6F6276E5|yqiG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATCATCTTCTTTCG, downstream forward: _UP4_TAATGTGCAAAGACTGCCGA
  • References

  • 22383849