SubtiBank SubtiBank
yqzN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqzN

unknown
locus
BSU26089
pI
9.52
mw
7.40 kDa
protein length
gene length
192 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,680,989 2,681,180

    Biological materials

    Mutant

  • BKE26089 ([gene|9D9C43D31DB672FC695F72F9F4DFC1905E6C3E97|yqzN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26089 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTCTCTTTTTTAGTGG, downstream forward: _UP4_TTTCTTCAAAAGGAGGTCAA
  • BKK26089 ([gene|9D9C43D31DB672FC695F72F9F4DFC1905E6C3E97|yqzN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26089 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTCTCTTTTTTAGTGG, downstream forward: _UP4_TTTCTTCAAAAGGAGGTCAA