SubtiBank SubtiBank
yorH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yorH

unknown
locus
BSU_20380
pI
9.60
mw
18.48 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,183,937 2,184,407

    Biological materials

    Mutant

  • BKE20380 ([gene|9D7790B5BE2DF6CC6BA0CA6DBA711FACFBFF5B9E|yorH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAATCACTCCTAATAA, downstream forward: _UP4_ATGCTATAGGAAGGAGAGTC
  • BKK20380 ([gene|9D7790B5BE2DF6CC6BA0CA6DBA711FACFBFF5B9E|yorH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAATCACTCCTAATAA, downstream forward: _UP4_ATGCTATAGGAAGGAGAGTC