SubtiBank SubtiBank
yfmA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfmA

unknown
locus
BSU_07540
pI
5.45
mw
6.15 kDa
protein length
gene length
168 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    827,252 827,419

    Expression and Regulation

    Operons

    genes
    [gene|9D4B8B6EDF69794135C5937B424B923B32C60B56|yfmA]-[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C331 (yfmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2329 NBRP B. subtilis, Japan]
  • BKE07540 ([gene|9D4B8B6EDF69794135C5937B424B923B32C60B56|yfmA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAACGCTGCCTTTATC, downstream forward: _UP4_TGAAAGAAATATAGAAAACA
  • BKK07540 ([gene|9D4B8B6EDF69794135C5937B424B923B32C60B56|yfmA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAACGCTGCCTTTATC, downstream forward: _UP4_TGAAAGAAATATAGAAAACA