SubtiBank SubtiBank
sspJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sspJ

small acid-soluble spore protein (minor)
locus
BSU_33340
pI
9.99
mw
5.03 kDa
protein length
gene length
141 bp Sequence Blast
function
protection of spore DNA
product
small acid-soluble spore protein (minor)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.3|Small acid-soluble spore proteins]
  • Gene

    Coordinates
    3,421,465 3,421,605

    The protein

    [SW|Localization]

  • spore core (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9D436951B6E1F9D570D8F55B6AC2E6C1230EF805|sspJ]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325,9852018], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]) [Pubmed|16497325,9852018]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BKE33340 ([gene|9D436951B6E1F9D570D8F55B6AC2E6C1230EF805|sspJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTATCACCTCTTTTA, downstream forward: _UP4_TAACCACATGCGGATAGGGC
  • BKK33340 ([gene|9D436951B6E1F9D570D8F55B6AC2E6C1230EF805|sspJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGTATCACCTCTTTTA, downstream forward: _UP4_TAACCACATGCGGATAGGGC
  • References

  • 9852018,16497325,30782632