SubtiBank SubtiBank
cgeA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cgeA

spore crust protein, maturation of the outermost layer of the spore
locus
BSU_19780
pI
3.98
mw
14.02 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast
function
maturation of the outermost layer of the spore
product
spore crust protein
essential
no
synonyms
cgeAA

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    2,148,676 2,149,077

    The protein

    [SW|Localization]

  • outermost layer of the spore coat (the spore crust), more abundant at the mother cell-proximal pole of the forespore [Pubmed|19933362,21665972]
  • Expression and Regulation

    Operons

    genes
    [gene|9D3D72FDF028A8468A92C583138397A5BD2FED59|cgeA]-[gene|405FD4EA1A5B2B3512F973981EF62CB37664B5F8|cgeB]
    description
    [Pubmed|7592393]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|7592393,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7592393], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|15621419], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|7592393]
  • view in new tab

    Biological materials

    Mutant

  • BKE19780 ([gene|9D3D72FDF028A8468A92C583138397A5BD2FED59|cgeA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACACACACCTCCTATT, downstream forward: _UP4_GTTACGTTCTTTTCATAACA
  • BKK19780 ([gene|9D3D72FDF028A8468A92C583138397A5BD2FED59|cgeA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACACACACCTCCTATT, downstream forward: _UP4_GTTACGTTCTTTTCATAACA
  • References

  • 7592393,15699190,19933362,15621419,21665972,28870294,30582883,31502725