SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore crust protein, maturation of the outermost layer of the spore
14.02 kDa
protein length
133 aa Sequence Blast
gene length
402 bp Sequence Blast
maturation of the outermost layer of the spore
spore crust protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • Gene

    2,148,676 2,149,077

    The protein


  • outermost layer of the spore coat (the spore crust), more abundant at the mother cell-proximal pole of the forespore [Pubmed|19933362,21665972]
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|7592393,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7592393], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|15621419], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|7592393]
  • view in new tab

    Biological materials


  • BKE19780 ([gene|9D3D72FDF028A8468A92C583138397A5BD2FED59|cgeA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACACACACCTCCTATT, downstream forward: _UP4_GTTACGTTCTTTTCATAACA
  • BKK19780 ([gene|9D3D72FDF028A8468A92C583138397A5BD2FED59|cgeA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACACACACCTCCTATT, downstream forward: _UP4_GTTACGTTCTTTTCATAACA
  • References

  • 7592393,15699190,19933362,15621419,21665972,28870294,30582883,31502725