SubtiBank SubtiBank
yokH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yokH

unknown
locus
BSU_21590
pI
4.19
mw
21.39 kDa
protein length
185 aa Sequence Blast
gene length
559 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • The protein

    Paralogous protein(s)

  • [protein|59FB4B286B814797FC2A3C0B42E1475364141A87|YobM]
  • Biological materials

    Mutant

  • 1A637 ( ''yokH''::''erm''), [Pubmed|3015878], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A637&Search=1A637 BGSC]
  • BKE21590 ([gene|9D3C94ED5DF019669EE9BB0F9A5D5976C42BFEB3|yokH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAAATCACCCCATATT, downstream forward: _UP4_TAGTGTGATGTATAAGACAG
  • BKK21590 ([gene|9D3C94ED5DF019669EE9BB0F9A5D5976C42BFEB3|yokH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATAAATCACCCCATATT, downstream forward: _UP4_TAGTGTGATGTATAAGACAG