SubtiBank SubtiBank
sivC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sivC

inhibitor of entry into sporulation via [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB] or [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC]
locus
BSU_15960
pI
8.61
mw
17.60 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
function
control of entry into sporulation via the phosphorelay
product
inhibitor of entry into sporulation
essential
no
synonyms
ylqB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.2|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.2|Proteins controlling the activity of the kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,671,166 1,671,651

    The protein

    Catalyzed reaction/ biological activity

  • inhibits [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB] or [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC] activity [Pubmed|23335417]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|9D320646C56FA83962BFBE73E22F2BCF2F0788B1|sivC]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B140 (ylqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1139 NBRP B. subtilis, Japan]
  • BKE15960 (''[gene|9D320646C56FA83962BFBE73E22F2BCF2F0788B1|sivC]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1823(''[gene|9D320646C56FA83962BFBE73E22F2BCF2F0788B1|sivC]''::''erm'', available in [SW|Jörg Stülke]'s lab)
  • BKE15960 ([gene|9D320646C56FA83962BFBE73E22F2BCF2F0788B1|sivC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCTCCTTAAAA, downstream forward: _UP4_TAAAAAAGAAAAAGGCCCCA
  • BKK15960 ([gene|9D320646C56FA83962BFBE73E22F2BCF2F0788B1|sivC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCTCCTTAAAA, downstream forward: _UP4_TAAAAAAGAAAAAGGCCCCA
  • References

  • 18957862,12107147,15033535,18840696,23335417