SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


inhibitor of entry into sporulation via [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB] or [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC]
17.60 kDa
protein length
161 aa Sequence Blast
gene length
486 bp Sequence Blast
control of entry into sporulation via the phosphorelay
inhibitor of entry into sporulation

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,671,166 1,671,651

    The protein

    Catalyzed reaction/ biological activity

  • inhibits [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB] or [protein|A656321846B2E0D1F39B528E2D8B8E620CCD1148|KinC] activity [Pubmed|23335417]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials


  • MGNA-B140 (ylqB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15960 (''[gene|9D320646C56FA83962BFBE73E22F2BCF2F0788B1|sivC]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1823(''[gene|9D320646C56FA83962BFBE73E22F2BCF2F0788B1|sivC]''::''erm'', available in [SW|Jörg Stülke]'s lab)
  • BKE15960 ([gene|9D320646C56FA83962BFBE73E22F2BCF2F0788B1|sivC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCTCCTTAAAA, downstream forward: _UP4_TAAAAAAGAAAAAGGCCCCA
  • BKK15960 ([gene|9D320646C56FA83962BFBE73E22F2BCF2F0788B1|sivC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCTCCTTAAAA, downstream forward: _UP4_TAAAAAAGAAAAAGGCCCCA
  • References

  • 18957862,12107147,15033535,18840696,23335417