SubtiBank SubtiBank
drm
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

drm

phosphopentomutase
locus
BSU_23500
pI
4.97
mw
43.77 kDa
protein length
394 aa Sequence Blast
gene length
1185 bp Sequence Blast
function
utilization of deoxyribose
product
phosphopentomutase
essential
no
ec
5.4.2.7
synonyms
yqkN

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    2,447,246 2,448,430

    The protein

    Catalyzed reaction/ biological activity

  • α-D-ribose 1-phosphate --> D-ribose 5-phosphate (according to UniProt)
  • 2-deoxy-α-D-ribose 1-phosphate --> 2-deoxy-D-ribose 5-phosphate (according to UniProt)
  • Protein family

  • phosphopentomutase family (single member, according to UniProt)
  • Modification

  • phosphorylation on (Thr-87 OR Thr-89) [Pubmed|17218307,17726680]
  • Structure

  • [PDB|3M8W] (from ''B. cereus'', 77% identity, 86% similarity) [Pubmed|21193409]
  • Expression and Regulation

    Operons

    genes
    [gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]-[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]
    description
    [Pubmed|10537218]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10537218], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of nucleosides (deoxyribose 5-phosphate and ribose 5-phosphate act as molecular inducers) [Pubmed|10537218]
  • view in new tab

    Biological materials

    Mutant

  • BKE23500 ([gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAAGCCTCCTTTT, downstream forward: _UP4_TAGGGGGACTGTTTCTTGAA
  • BKK23500 ([gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAAGCCTCCTTTT, downstream forward: _UP4_TAGGGGGACTGTTTCTTGAA
  • References

  • 10537218,17218307,17726680,22900538