SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


43.77 kDa
protein length
394 aa Sequence Blast
gene length
1185 bp Sequence Blast
utilization of deoxyribose

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    2,447,246 2,448,430

    The protein

    Catalyzed reaction/ biological activity

  • α-D-ribose 1-phosphate --> D-ribose 5-phosphate (according to UniProt)
  • 2-deoxy-α-D-ribose 1-phosphate --> 2-deoxy-D-ribose 5-phosphate (according to UniProt)
  • Protein family

  • phosphopentomutase family (single member, according to UniProt)
  • Modification

  • phosphorylation on (Thr-87 OR Thr-89) [Pubmed|17218307,17726680]
  • Structure

  • [PDB|3M8W] (from ''B. cereus'', 77% identity, 86% similarity) [Pubmed|21193409]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10537218], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of nucleosides (deoxyribose 5-phosphate and ribose 5-phosphate act as molecular inducers) [Pubmed|10537218]
  • view in new tab

    Biological materials


  • BKE23500 ([gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAAGCCTCCTTTT, downstream forward: _UP4_TAGGGGGACTGTTTCTTGAA
  • BKK23500 ([gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTGAAAGCCTCCTTTT, downstream forward: _UP4_TAGGGGGACTGTTTCTTGAA
  • References

  • 10537218,17218307,17726680,22900538