SubtiBank SubtiBank
yqxK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqxK

similar to lesion-specific endonuclease EndoQ
locus
BSU_23600
pI
8.45
mw
32.03 kDa
protein length
387 aa Sequence Blast
gene length
1164 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqkH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    2,457,349 2,458,512

    The protein

    Structure

  • [PDB|5ZB8] (from Pyrococcus furiosus, 34% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CF38BE04F04919BB304789E9B3FE489385E468E6|nudF]-[gene|9D05B104000EED08FB62D6F362FC5E9C2A5354D9|yqxK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE23600 ([gene|9D05B104000EED08FB62D6F362FC5E9C2A5354D9|yqxK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGCAAATCCGCGTAAATCT, downstream forward: _UP4_AAAATTAAACCGTGAGCTAA
  • BKK23600 ([gene|9D05B104000EED08FB62D6F362FC5E9C2A5354D9|yqxK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGCAAATCCGCGTAAATCT, downstream forward: _UP4_AAAATTAAACCGTGAGCTAA
  • References

    Research papers

  • 29660024