SubtiBank SubtiBank
yqxK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqxK

similar to lesion-specific endonuclease EndoQ
locus
BSU_23600
pI
8.45
mw
32.03 kDa
protein length
387 aa Sequence Blast
gene length
1164 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqkH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    2,457,349 2,458,512

    The protein

    Structure

  • [PDB|5ZB8] (from Pyrococcus furiosus, 34% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|CF38BE04F04919BB304789E9B3FE489385E468E6|nudF]-[gene|9D05B104000EED08FB62D6F362FC5E9C2A5354D9|yqxK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE23600 ([gene|9D05B104000EED08FB62D6F362FC5E9C2A5354D9|yqxK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGCAAATCCGCGTAAATCT, downstream forward: _UP4_AAAATTAAACCGTGAGCTAA
  • BKK23600 ([gene|9D05B104000EED08FB62D6F362FC5E9C2A5354D9|yqxK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTGCAAATCCGCGTAAATCT, downstream forward: _UP4_AAAATTAAACCGTGAGCTAA
  • References

    Research papers

  • 29660024