SubtiBank SubtiBank
yyaQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yyaQ

unknown
locus
BSU_40750
pI
5.82
mw
13.77 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,186,092 4,186,448

    The protein

    Structure

  • [PDB|2KFP] (from Pseudomonas syringae, 44% identity) [pubmed|22865330]
  • Expression and Regulation

    Operons

    genes
    [gene|9CDE4E596FF563B682E839F82B7CD96CE58FCA8D|yyaQ]
    description
    [pubmed|29794222]
    regulation
    the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B857 (yyaQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1856 NBRP B. subtilis, Japan]
  • BKE40750 ([gene|9CDE4E596FF563B682E839F82B7CD96CE58FCA8D|yyaQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTCAATCACTCCTTTA, downstream forward: _UP4_TGAAGATAAAGAGTGTTCCT
  • BKK40750 ([gene|9CDE4E596FF563B682E839F82B7CD96CE58FCA8D|yyaQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACTCAATCACTCCTTTA, downstream forward: _UP4_TGAAGATAAAGAGTGTTCCT
  • References

  • 20525796,22865330,29794222