SubtiBank SubtiBank
ybdN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybdN

unknown
locus
BSU_02040
pI
8.80
mw
31.35 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    224,075 224,932

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic growth ([protein|search|AbrB]) [Pubmed|18840696]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B959 (ybdN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1958 NBRP B. subtilis, Japan]
  • BKE02040 ([gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACAACCTCCTTTT, downstream forward: _UP4_TAACTTATACCGAGCCGGTT
  • BKK02040 ([gene|9C9F5F02DE6E08986072307EED78A931672AC642|ybdN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACAACCTCCTTTT, downstream forward: _UP4_TAACTTATACCGAGCCGGTT
  • References

  • 18957862,18840696,20709850