SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|ABC transporter] (hydrophobic protein, probably channel protein)
36.28 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
[SW|ABC transporter] (hydrophobic protein, probably channel protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Unknown ABC transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,115,989 3,116,966

    The protein

    Protein family

  • ABC-5 integral membrane protein family (with [protein|31977FDC549E45911C333623DCA3D8941A93D8FF|YtrC], according to UniProt)
  • Paralogous protein(s)

  • [protein|31977FDC549E45911C333623DCA3D8941A93D8FF|YtrC]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10986249,21856850], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA]: repression, [Pubmed|10986249,21856850], in [regulon|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|YtrA regulon]
  • regulation

  • expressed early in the stationary phase [Pubmed|10986249]
  • view in new tab

    Biological materials


  • GP2646 Δ([gene|DCFA6025F7B4D7C5F6FB8107DDA6538CED33084D|ytrG]-[gene|6A074CE9AD98A2751A216A2EA8156ACE6FFC7280|ytrA]-[gene|BF81AD95FE6CF7662D012EF293C769E80C093D34|ytrB]-[gene|31977FDC549E45911C333623DCA3D8941A93D8FF|ytrC]-[gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]-[gene|4FE6A51A0D9BBBF574EA2EF18B95B5BFC0A64CCB|ytrE]-[gene|9024AB63030C1934A954EE6A378CADBDC977E863|ytrF])::''ermC'', available in [SW|Jörg Stülke]'s lab
  • MGNA-B538 (ytrD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30430 ([gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]::erm trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CAACTCACTTCCCTCCAAAC, downstream forward: _UP4_TAAGGGAGAGAGAACATATG
  • BKK30430 ([gene|9C8233C48733A1E9271EE7AA1283EA9F446CF9DA|ytrD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTCACTTCCCTCCAAAC, downstream forward: _UP4_TAAGGGAGAGAGAACATATG
  • References

  • 10986249,10092453,12399512