SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


galactarate/glucarate transporter in (proton symport)
49.09 kDa
protein length
455 aa Sequence Blast
gene length
1368 bp Sequence Blast
glucarate uptake
galactarate/glucarate transporter in (proton symport)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucarate/galactarate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    270,396 271,763

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • Phthalate permease family (with [protein|6D08E897DD697523FD0720704A25AD4472075B6C|ExuT] and [protein|41AB19B291C766E55CA1C5BAEF157FD26B5D4297|YybO], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG]: repression, [Pubmed|12044674], in [regulon|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
  • view in new tab

    Biological materials


  • MGNA-C028 (ycbE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02480 ([gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTATCTTCTCCTTTTC, downstream forward: _UP4_TAATATTTATGAAAGCGCTT
  • BKK02480 ([gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGTATCTTCTCCTTTTC, downstream forward: _UP4_TAATATTTATGAAAGCGCTT
  • References

  • 12044674