SubtiBank SubtiBank
yuxL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuxL

similar to acylaminoacyl-peptidase
locus
BSU32230
pI
5.10
mw
73.53 kDa
protein length
657 aa Sequence Blast
gene length
1974 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,310,763 3,312,736

    The protein

    Protein family

  • peptidase S9B family (according to Swiss-Prot)
  • Structure

  • [PDB|4HXE] (from Pyrococcus horikoshii, 28% identity) [pubmed|23632025]
  • Expression and Regulation

    Operons

    genes
    [gene|9BF1545C645422F51257FD658C9B50ACEEDD2E45|yuxL]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B577 (yuxL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1576 NBRP B. subtilis, Japan]
  • BKE32230 ([gene|9BF1545C645422F51257FD658C9B50ACEEDD2E45|yuxL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATCTCCTCCTTTT, downstream forward: _UP4_TAATAAAAAAGCCAGGCTGA
  • BKK32230 ([gene|9BF1545C645422F51257FD658C9B50ACEEDD2E45|yuxL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCATCTCCTCCTTTT, downstream forward: _UP4_TAATAAAAAAGCCAGGCTGA
  • References

    Research papers

  • 23632025