SubtiBank SubtiBank
yqjX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqjX

unknown
locus
BSU_23700
pI
5.26
mw
13.03 kDa
protein length
112 aa Sequence Blast
gene length
339 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,464,227 2,464,565

    The protein

    Paralogous protein(s)

  • [protein|A9D5625FF5F1A3845FF6F8A290F647CCA73D39EF|YolD], [protein|94F2146AC6998CC77CD2E86CE8BE8DC98AEBB9CD|YozL]
  • Expression and Regulation

    Operons

    genes
    [gene|F0BC150F59730E64BA9AB3F979544EF6B5CC4E9E|polY2]-[gene|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|yqjX]-[gene|5B8A6D282E34683726BD6C36E09A6C36E8F99795|yqjY]-[gene|9F88AC3A792F4EE8AA853849BBCF5065717B1D8B|yqjZ]-[gene|3ECD25A4ED9556E74112285B11FC180A7091D730|yqkA]-[gene|DC1C1D4BE1A7F4E28792A2B8273AFE2C7F90E58C|yqkB]-[gene|30363923724EBD39C27967B25B486C71453190D1|yqkC]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|15469515,16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|15469515,16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C404 (yqjX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2402 NBRP B. subtilis, Japan]
  • BKE23700 ([gene|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|yqjX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTGCCCCTTTTTAAATGGT, downstream forward: _UP4_TAAAGTCTCTCCTCCTGTTT
  • BKK23700 ([gene|9BC3DF46C944A0FD5CAAB4513C4AF00EFC5FC8D5|yqjX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23700 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTGCCCCTTTTTAAATGGT, downstream forward: _UP4_TAAAGTCTCTCCTCCTGTTT
  • References

  • 16267290,30916324,30916324