SubtiBank SubtiBank
yokJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yokJ

putative antitoxin
locus
BSU_21570
pI
4.13
mw
18.76 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
function
inhibition of the cytotoxic activity of [protein|13C081250872E72C61C49D8F77AC5AF4B6D431A3|YokI]
product
putative antitoxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,275,200 2,275,697

    Expression and Regulation

    Operons

    genes
    [gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]-[gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]-[gene|8BA8DB1483190AB847F28F3E56C247FE85C3225E|yokK]-[gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE21570 ([gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAATGCTCAAGTCCG, downstream forward: _UP4_TAATCTATTAAACAAAAGTA
  • BKK21570 ([gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAATGCTCAAGTCCG, downstream forward: _UP4_TAATCTATTAAACAAAAGTA
  • References

  • 22200572,20817675