SubtiBank SubtiBank
yokJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yokJ

putative antitoxin
locus
BSU_21570
pI
4.13
mw
18.76 kDa
protein length
165 aa Sequence Blast
gene length
498 bp Sequence Blast
function
inhibition of the cytotoxic activity of [protein|13C081250872E72C61C49D8F77AC5AF4B6D431A3|YokI]
product
putative antitoxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,275,200 2,275,697

    Expression and Regulation

    Operons

    genes
    [gene|13C081250872E72C61C49D8F77AC5AF4B6D431A3|yokI]-[gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]-[gene|8BA8DB1483190AB847F28F3E56C247FE85C3225E|yokK]-[gene|9A03964C94A9253B3D9AAA60ACA0651AED49A627|yokL]
    description
    [Pubmed|20817675]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE21570 ([gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAATGCTCAAGTCCG, downstream forward: _UP4_TAATCTATTAAACAAAAGTA
  • BKK21570 ([gene|9BC2309D7FC93CD4195849BFCF195ED3EBC3CAF1|yokJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAATGCTCAAGTCCG, downstream forward: _UP4_TAATCTATTAAACAAAAGTA
  • References

  • 22200572,20817675