SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


phosphoribosylglycinamide synthetase
45.12 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
purine biosynthesis
phosphoribosylglycinamide synthetase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    710,148 711,416

    The protein

    Catalyzed reaction/ biological activity

  • ATP 5-phospho-D-ribosylamine glycine = ADP phosphate N(1)-(5-phospho-D-ribosyl)glycinamide (according to Swiss-Prot)
  • Protein family

  • ATP-grasp domain (according to Swiss-Prot)
  • Structure

  • [PDB|2XCL]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE06530 ([gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTCACGTCGTTTTCAT, downstream forward: _UP4_TAAGTGAGGAAAACCCGCAG
  • BKK06530 ([gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTCACGTCGTTTTCAT, downstream forward: _UP4_TAAGTGAGGAAAACCCGCAG
  • References

  • 3036807,12923093,15378759,7638212