SubtiBank SubtiBank
purD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

purD

phosphoribosylglycinamide synthetase
locus
BSU_06530
pI
4.60
mw
45.12 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylglycinamide synthetase
essential
no
ec
6.3.4.13
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    710,148 711,416

    The protein

    Catalyzed reaction/ biological activity

  • 5-phospho-D-ribosylamine + ATP + glycine --> ADP + H+ + N1-(5-phospho-D-ribosyl)glycinamide + phosphate (according to UniProt)
  • Protein family

  • GARS family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|ATP-grasp doamin] (aa 107-313) (according to UniProt)
  • Structure

  • [PDB|2XCL]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06530 ([gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTCACGTCGTTTTCAT, downstream forward: _UP4_TAAGTGAGGAAAACCCGCAG
  • BKK06530 ([gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TACATTCACGTCGTTTTCAT, downstream forward: _UP4_TAAGTGAGGAAAACCCGCAG
  • References

  • 3036807,12923093,15378759,7638212