SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


type III pantothenate kinase
26.07 kDa
protein length
258 aa Sequence Blast
gene length
777 bp Sequence Blast
biosynthesis of coenzyme A
pantothenate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of coenzyme A]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    79,092 79,868

    The protein

    Catalyzed reaction/ biological activity

  • (R)-pantothenate + ATP --> (R)-4'-phosphopantothenate + ADP + H+ (according to UniProt)
  • Protein family

  • type III pantothenate kinase family (single member, according to UniProt)
  • Structure

  • [PDB|2H3G] (from ''Bacillus anthracis str. ames'', 75% identity, 88% similarity) [Pubmed|17323930]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30480837], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by heat stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30480837]
  • view in new tab


    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • view in new tab

    Biological materials


  • MGNA-B923 (yacB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00700 ([gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTCTATCACCACTTTT, downstream forward: _UP4_GGAAGTGTATAGGAGGTTTA
  • BKK00700 ([gene|9B8EAD4EDDA97526D4462F6F3205F81FECD039DE|coaX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCTCTATCACCACTTTT, downstream forward: _UP4_GGAAGTGTATAGGAGGTTTA
  • References

  • 15795230,18179421,24784177