SubtiBank SubtiBank
yetK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yetK

unknown
locus
BSU_07210
pI
9.53
mw
35.60 kDa
protein length
330 aa Sequence Blast
gene length
993 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    788,636 789,628

    The protein

    Protein family

  • [SW|EamA transporter family] (according to UniProt)
  • [SW|Domains]

  • 2 [SW|EamA domain]s (aa 38-163, 187-314) (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F0A217DB65ED7A7539F775FEBC5D88718B4958BD|yetJ]-[gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|1F2E7B30C04E8C58DDC3583A9C912BD480E979F7|yezD]-[gene|F0A217DB65ED7A7539F775FEBC5D88718B4958BD|yetJ]-[gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B462 (yetK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1461 NBRP B. subtilis, Japan]
  • BKE07210 ([gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATCACTGCTCAA, downstream forward: _UP4_TAGCCTGTCCGGATCGGACG
  • BKK07210 ([gene|9B8857B4493AD36A2395372B00273244D291BBA7|yetK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATCATCACTGCTCAA, downstream forward: _UP4_TAGCCTGTCCGGATCGGACG