SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


hydroxyethylthiazole kinase
28.06 kDa
protein length
272 aa Sequence Blast
gene length
819 bp Sequence Blast
biosynthesis of thiamine
hydroxyethylthiazole kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of thiamine]
  • Gene

    3,931,372 3,932,190

    The protein

    Catalyzed reaction/ biological activity

  • 5-(2-hydroxyethyl)-4-methylthiazole + ATP --> 4-methyl-5-(2-phosphooxyethyl)-thiazole + ADP + H+ (according to UniProt)
  • Protein family

  • Thz kinase family (single member, according to UniProt)
  • Structure

  • [PDB|1C3Q]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9139923], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • BKE38300 ([gene|9B82059498F72A67282DD54892EF02A305E3C674|thiM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGCATCATCCTTTA, downstream forward: _UP4_TCATGACTCGTATTTCTCGG
  • BKK38300 ([gene|9B82059498F72A67282DD54892EF02A305E3C674|thiM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGCATCATCCTTTA, downstream forward: _UP4_TCATGACTCGTATTTCTCGG
  • References


  • 19348578
  • Original publications

  • 10891066,9139923