SubtiBank SubtiBank
thiM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thiM

hydroxyethylthiazole kinase
locus
BSU_38300
pI
5.39
mw
28.06 kDa
protein length
272 aa Sequence Blast
gene length
819 bp Sequence Blast
function
biosynthesis of thiamine
product
hydroxyethylthiazole kinase
essential
no
ec
2.7.1.50
synonyms
thiK,ipa-25d,ywbJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • Gene

    Coordinates
    3,931,372 3,932,190

    The protein

    Catalyzed reaction/ biological activity

  • 5-(2-hydroxyethyl)-4-methylthiazole + ATP --> 4-methyl-5-(2-phosphooxyethyl)-thiazole + ADP + H+ (according to UniProt)
  • Protein family

  • Thz kinase family (single member, according to UniProt)
  • Structure

  • [PDB|1C3Q]
  • Expression and Regulation

    Operons

    genes
    [gene|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]-[gene|9B82059498F72A67282DD54892EF02A305E3C674|thiM]-[gene|8FAEB6342E087BEDC16FDF5585B03B90ACFF8D11|thiE]
    description
    [Pubmed|9139923]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9139923], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE38300 ([gene|9B82059498F72A67282DD54892EF02A305E3C674|thiM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGCATCATCCTTTA, downstream forward: _UP4_TCATGACTCGTATTTCTCGG
  • BKK38300 ([gene|9B82059498F72A67282DD54892EF02A305E3C674|thiM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTGCATCATCCTTTA, downstream forward: _UP4_TCATGACTCGTATTTCTCGG
  • References

    Reviews

  • 19348578
  • Original publications

  • 10891066,9139923