SubtiBank SubtiBank
epsB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

epsB

extracellular polysaccharide synthesis, protein tyrosine kinase, phosphorylation of [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|EpsE]
locus
BSU_34360
pI
9.92
mw
24.53 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
function
biofilm formation
product
protein tyrosine kinase
essential
no
synonyms
yveL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.1|Matrix polysaccharide synthesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    3,528,462 3,529,145

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylation of [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|EpsE], to stimulate [protein|5D717F9F54693FD0AA8BC49E10348637858F88B9|EpsE] activity and biofilm formation [pubmed|25085422]
  • ATP + L-tyrosyl-[protein] --> ADP + H+ + O-phospho-L-tyrosyl-[protein] (according to UniProt)
  • Protein family

  • BY kinase, see the [http://bykdb.ibcp.fr/BYKdb/BYKdbHelp Bacterial Protein Tyrosine Kinase Database]
  • CpsD/CapB family (with [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA], according to UniProt)
  • Paralogous protein(s)

  • [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]
  • Modification

  • autophosphorylated on Tyr-225 and Tyr-227 [Pubmed|25085422]
  • Structure

  • [PDB|2VED] (CapB, the homolog in ''Staphylococcus aureus'') [Pubmed|18547145]
  • Expression and Regulation

    Operons

    genes
    [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
    description
    [Pubmed|15661000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541]
  • expression is increased in [gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX] mutants [pubmed|32483306]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A072 (yveL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/72 NBRP B. subtilis, Japan]
  • GP1518 (aphA3) [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • GP1519 (''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]'', aphA3) [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • BKE34360 ([gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC, downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG
  • BKK34360 ([gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTTTTCTAAAGATCACTC, downstream forward: _UP4_TAGTTTTTGTAAAGGTGATG
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]) [Pubmed|24493247], available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1541 epsB-FLAG 3x spc (based on [SW|pGP1331]) available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

    Reviews

  • 20735481,24554699,25540643
  • Original publications

  • 15661000,16430695,18047568,18647168,18547145,20817675,21856853,21815947,23646920,24493247,24728941,25085422