SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


spore coat polysaccharide synthesis
37.82 kDa
protein length
339 aa Sequence Blast
gene length
1020 bp Sequence Blast
spore coat polysaccharide synthesis

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,886,004 3,887,023

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • BKE37850 ([gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGAAGATCCCAACATGCA, downstream forward: _UP4_TAAAAATGCATGTAAGGAAG
  • BKK37850 ([gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGAAGATCCCAACATGCA, downstream forward: _UP4_TAAAAATGCATGTAAGGAAG
  • References

  • 9353933,15383836,25239894,26577401