SubtiBank SubtiBank
spsG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

spsG

legionaminic acid synthesis
locus
BSU_37850
pI
6.56
mw
37.82 kDa
protein length
339 aa Sequence Blast
gene length
1020 bp Sequence Blast
function
legionaminic acid synthesis
product
unknown
essential
no
synonyms
ipa-69d,spsH

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.8|Biosynthesis of legionaminic acid (for spore crust))]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,886,004 3,887,023

    Phenotypes of a mutant

  • less hydrophobic spore surface [pubmed|32817102]
  • The protein

    Catalyzed reaction/ biological activity

  • required for spore crust assembly, legionaminic acid synthesis [pubmed|32817102]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]-[gene|9E577B935FAB9605DAF83353E907A6561F11CAC1|spsB]-[gene|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC]-[gene|2648D9E356683F5E9C00C40F0A6BBD1933322B09|spsD]-[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]-[gene|222F7086A214A427174E188CB1FEE4A8B98D303C|spsF]-[gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]-[gene|8A80A058F270C134891CBCE7EBD8D7A23797F599|spsI]-[gene|90D505CAA4FAAEB6A6AF5C278E70DF714FACB4DA|spsJ]-[gene|4A4C5E6C1DFD46BC3CF9AEBA3FC1577767FF8465|spsK]-[gene|F87238E9B22F967370971ABA4F911EFAC4F559B5|spsL]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE37850 ([gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGAAGATCCCAACATGCA, downstream forward: _UP4_TAAAAATGCATGTAAGGAAG
  • BKK37850 ([gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGAAGATCCCAACATGCA, downstream forward: _UP4_TAAAAATGCATGTAAGGAAG
  • References

  • 9353933,15383836,25239894,26577401,32817102