SubtiBank SubtiBank
thiV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

thiV

thiamine [SW|ECF transporter] (membrane protein, thiamine-specific S protein)
locus
BSU_13230
pI
9.89
mw
21.02 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast
function
thiamine uptake
product
thiamine [SW|ECF transporter] (membrane protein, thiamine-specific S protein)
essential
no
synonyms
ykoE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW 1.2.3.3|Class I ECF transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.3|Biosynthesis/ acquisition of thiamine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,390,439 1,391,038

    The protein

    Structure

  • [PDB|5EDL] [pubmed|27447050]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|57A953B5D71F3FD8269EAF2366B8E2C7A8C79483|thiU]-[gene|9AF27E4CE34B5C4036840A27D93B13213E3324DD|thiV]-[gene|EF69891D9CF0CE57367B38FB3C69DDE1B689FCB7|thiW]-[gene|236095EDE02EC9EA7768D9D30CED2345D3B7A1A9|thiX]
    description
    [Pubmed|16291685]

    regulatory mechanism

  • [protein|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box]: [SW|RNA switch], via [SW|RNA switch], in [regulon|E195900D971AEE4A790D4579BE5E5A15B81010B8|Thi-box regulon]
  • regulation

  • repressed by thiamine ([protein|search|Thi-box]) [Pubmed|12376536]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A756 (ykoE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/756 NBRP B. subtilis, Japan]
  • BKE13230 ([gene|9AF27E4CE34B5C4036840A27D93B13213E3324DD|thiV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTTACTTTCCAGCTTT, downstream forward: _UP4_AAGAAACGGAAGCGGGCGTC
  • BKK13230 ([gene|9AF27E4CE34B5C4036840A27D93B13213E3324DD|thiV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTTACTTTCCAGCTTT, downstream forward: _UP4_AAGAAACGGAAGCGGGCGTC
  • References

  • 10092453,16291685,12376536,18763711,27447050