SubtiBank SubtiBank
ycsG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ycsG

putative transporter
locus
BSU_04060
pI
10.15
mw
41.93 kDa
protein length
404 aa Sequence Blast
gene length
1215 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ycsH

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    457,811 459,025

    Phenotypes of a mutant

  • no growth with 5-oxoproline as single source of nitrogen [pubmed|28830929]
  • The protein

    Protein family

  • NRAMP family (with [protein|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|MntH], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
    description
    [Pubmed|9334321]

    regulatory mechanism

  • [protein|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR]: repression, [Pubmed|9334321], in [regulon|7DA9A79876C546B78B716A64706A3A3716018C2E|KipR regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|9334321], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced in the presence of 5-oxoproline [pubmed|28830929]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C022 (ycsG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2020 NBRP B. subtilis, Japan]
  • BKE04060 ([gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTCCATCTATTGTTCCT, downstream forward: _UP4_TGATATAAGTGGAGCAATTA
  • BKK04060 ([gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGCTCCATCTATTGTTCCT, downstream forward: _UP4_TGATATAAGTGGAGCAATTA
  • References

  • 9334321,25755103,28830929