SubtiBank SubtiBank
ybxG [2019-06-07 08:26:04]
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

ybxG [2019-06-07 08:26:04]

similar to amino acid permease, putative threonine transporter
49.94 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|APC superfamily]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    226,566 227,954

    Phenotypes of a mutant

  • a [gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG] mutant confers resistance to 4-hydroxythreonine [pubmed|25777134]
  • The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW]
  • Structure

  • [PDB|5OQT] (from Geobacillus kaustophilus, 23% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP2396 ∆''[gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]'' ::''cat'' available in [SW|Jörg Stülke]'s lab
  • BKE02060 (''[gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]''::''erm''), available in the BGSC and in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE02060 ([gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT
  • BKK02060 ([gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT
  • Expression vector

  • pGP2299 (expression with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12850135,29416041,25777134