SubtiBank SubtiBank
ybxG [2019-02-04 16:19:52]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ybxG [2019-02-04 16:19:52]

similar to amino acid permease, putative threonine transporter
locus
BSU02060
pI
9.60
mw
49.94 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ybdP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    226,566 227,954

    Phenotypes of a mutant

  • a [gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG] mutant confers resistance to 4-hydroxythreonine [pubmed|25777134]
  • The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW]
  • Structure

  • [PDB|5OQT] (from Geobacillus kaustophilus, 23% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2396 (''[gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]''::''cat'') available in [SW|Jrg Stlke]'s lab
  • BKE02060 (''[gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]''::''erm'', available in the BGSC and in [SW|Fabian Commichau]'s and [SW|Jrg Stlke]'s labs) [pubmed|28189581]
  • BKE02060 ([gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT
  • BKK02060 ([gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT
  • References

  • 12850135,29416041,25777134