SubtiBank SubtiBank
ybxG [2019-02-04 16:19:52]
Don't miss! The Virtual International Conference on Bacillus will take place from June 8 to June 12! Website

ybxG [2019-02-04 16:19:52]

similar to amino acid permease, putative threonine transporter
locus
BSU02060
pI
9.60
mw
49.94 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ybdP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    226,566 227,954

    Phenotypes of a mutant

  • a [gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG] mutant confers resistance to 4-hydroxythreonine [pubmed|25777134]
  • The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW]
  • Structure

  • [PDB|5OQT] (from Geobacillus kaustophilus, 23% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2396 (''[gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]''::''cat'') available in [SW|Jrg Stlke]'s lab
  • BKE02060 (''[gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]''::''erm'', available in the BGSC and in [SW|Fabian Commichau]'s and [SW|Jrg Stlke]'s labs) [pubmed|28189581]
  • BKE02060 ([gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT
  • BKK02060 ([gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT
  • References

  • 12850135,29416041,25777134