SubtiBank SubtiBank
ybxG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ybxG

amino acid permease, minor threonine and serine transporter
locus
BSU_02060
pI
9.60
mw
49.94 kDa
protein length
462 aa Sequence Blast
gene length
1389 bp Sequence Blast
function
uptake of threonine and serine
product
amino acid permease
essential
no
synonyms
ybdP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.8|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.8|Utilization of threonine/ glycine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    226,566 227,954

    Phenotypes of a mutant

  • a [gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG] mutant confers resistance to 4-hydroxythreonine [pubmed|25777134]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of threonine and serine [pubmed|32743959]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW]
  • Structure

  • [PDB|5OQT] (from Geobacillus kaustophilus, 23% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2396 ∆''[gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]'' ::''cat'' available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • BKE02060 (''[gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]''::''erm''), available in the BGSC and in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE02060 ([gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT
  • BKK02060 ([gene|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|ybxG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCTCTTCCTCCTCCTA, downstream forward: _UP4_TAACGATAAAAAAGAGACAT
  • Expression vector

  • pGP2299 (expression with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 12850135,29416041,25777134,32743959