SubtiBank SubtiBank
yetO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yetO

cytochrome P450 (CYP102A2)/ NADPH-cytochrome P450 reductase
locus
BSU_07250
pI
5.73
mw
119.26 kDa
protein length
1061 aa Sequence Blast
gene length
3186 bp Sequence Blast
function
fatty acid metabolism
product
NADPH-cytochrome P450 reductase
essential
no
ec
1.6.2.4
synonyms
yfnJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    792,682 795,867

    The protein

    Catalyzed reaction/ biological activity

  • oxidation of even- and odd-chain saturated and unsaturated fatty acids to the respective omega-3, omega-2 and omega-1 hydroxylated fatty acids [Pubmed|15375636]
  • alkane + O2 + reduced [NADPH—hemoprotein reductase] --> primary alcohol + H+ + H2O + oxidized [NADPH—hemoprotein reductase] (according to UniProt)
  • NADPH + 2 oxidized [cytochrome P450] --> H+ + NADP+ + 2 reduced [cytochrome P450] (according to UniProt)
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|YrhJ]
  • [SW|Domains]

  • [SW|Flavodoxin-like domain] (aa 493-632) (according to UniProt)
  • [SW|FAD-binding FR-type domain] (aa 671-904) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2X7Y] (from ''Bacillus megaterium''; 66% identity, 87% similarity) [Pubmed|25325618,22949185]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9AA8CAEB42B1ED4CC8D80D57B045A55307114D6A|yetO]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C225 (yfnJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2223 NBRP B. subtilis, Japan]
  • BKE07250 ([gene|9AA8CAEB42B1ED4CC8D80D57B045A55307114D6A|yetO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCATTCCTTTCCG, downstream forward: _UP4_TAGATAAAGAAGACTGGAGA
  • BKK07250 ([gene|9AA8CAEB42B1ED4CC8D80D57B045A55307114D6A|yetO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCATTCCTTTCCG, downstream forward: _UP4_TAGATAAAGAAGACTGGAGA
  • References

  • 15122913,15375636,16716428,15857787,11734890,21048857,25325618,22949185