SubtiBank SubtiBank
yetO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yetO

cytochrome P450 (CYP102A2)/ NADPH-cytochrome P450 reductase
locus
BSU_07250
pI
5.73
mw
119.26 kDa
protein length
1061 aa Sequence Blast
gene length
3186 bp Sequence Blast
function
fatty acid metabolism
product
NADPH-cytochrome P450 reductase
essential
no
ec
1.6.2.4
synonyms
yfnJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    792,682 795,867

    The protein

    Catalyzed reaction/ biological activity

  • oxidation of even- and odd-chain saturated and unsaturated fatty acids to the respective omega-3, omega-2 and omega-1 hydroxylated fatty acids [Pubmed|15375636]
  • alkane + O2 + reduced [NADPH—hemoprotein reductase] --> primary alcohol + H+ + H2O + oxidized [NADPH—hemoprotein reductase] (according to UniProt)
  • NADPH + 2 oxidized [cytochrome P450] --> H+ + NADP+ + 2 reduced [cytochrome P450] (according to UniProt)
  • Protein family

  • [SW|cytochrome P450] family (according to UniProt)
  • Paralogous protein(s)

  • [protein|4BA5214C441C6671CB7DAA3CACBCA5FC025BE0E6|YrhJ]
  • [SW|Domains]

  • [SW|Flavodoxin-like domain] (aa 493-632) (according to UniProt)
  • [SW|FAD-binding FR-type domain] (aa 671-904) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2X7Y] (from ''Bacillus megaterium''; 66% identity, 87% similarity) [Pubmed|25325618,22949185]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9AA8CAEB42B1ED4CC8D80D57B045A55307114D6A|yetO]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C225 (yfnJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2223 NBRP B. subtilis, Japan]
  • BKE07250 ([gene|9AA8CAEB42B1ED4CC8D80D57B045A55307114D6A|yetO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCATTCCTTTCCG, downstream forward: _UP4_TAGATAAAGAAGACTGGAGA
  • BKK07250 ([gene|9AA8CAEB42B1ED4CC8D80D57B045A55307114D6A|yetO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGAACCATTCCTTTCCG, downstream forward: _UP4_TAGATAAAGAAGACTGGAGA
  • References

  • 15122913,15375636,16716428,15857787,11734890,21048857,25325618,22949185