SubtiBank SubtiBank
dctS

dctS

two-component sensor kinase, regulation of the [gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]-[gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]-[gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP] operon
locus
BSU_04450
pI
6.20
mw
59.77 kDa
protein length
535 aa Sequence Blast
gene length
1608 bp Sequence Blast
function
regulation of the [gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]-[gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]-[gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP] operon
product
two-component sensor kinase
essential
no
synonyms
ydbF

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    497,768 499,375

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|97C34F6FA0B89D93369150E9A8AB3579332B07BC|DctR]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • two transmembrane segments
  • [SW|PAS domain] (aa 213–276) (according to UniProt)
  • [SW|Histidine kinase domain] (aa 333-528) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • [protein|7428E80AC67A659B8602AF887EA7DFFD4976B40C|DctB] and [protein|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|DctP] act as co-sensors with [protein|9A96572B101358768EB20EE9438BE0E1424A4130|DctS] [Pubmed|24375102]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]-[gene|97C34F6FA0B89D93369150E9A8AB3579332B07BC|dctR]-[gene|107DDCC7B6AA2D7CB02E53F043A93CF05C679081|dctP]
    description
    [Pubmed|10708364]

    regulation

  • part of the iron sparing response, strong down-regulation in a'' [protein|search|fur]'' mutant ([protein|search|Fur], [protein|search|FsrA]) [Pubmed|22389480]
  • view in new tab

    Biological materials

    Mutant

  • GP225 (''dctS''::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE04450 ([gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTTCTCCTTTCAGG, downstream forward: _UP4_CCAATGAAGGGGGAGGAAGC
  • BKK04450 ([gene|9A96572B101358768EB20EE9438BE0E1424A4130|dctS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04450 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGCTTCTCCTTTCAGG, downstream forward: _UP4_CCAATGAAGGGGGAGGAAGC
  • References

  • 10094672,10708364,24375102