SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to peptidase
47.04 kDa
protein length
428 aa Sequence Blast
gene length
1287 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,758,314 1,759,600

    The protein

    Protein family

  • [SW|Peptidase M16 family] (according to UniProt)
  • Structure

  • [PDB|4XEA] (from Alicyclobacillus acidocaldarius, 43% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|A7326377132C670B60695EFE0A652B1E4F623698|Mta]: activation, [Pubmed|18502870], in [regulon|A7326377132C670B60695EFE0A652B1E4F623698|Mta regulon]
  • view in new tab

    Biological materials


  • MGNA-A025 (ymfH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16860 ([gene|9A5EB7CA38D948007AD788297128035AB4074490|ymfH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTTCATATTCGATTGGTT, downstream forward: _UP4_TAAACAAAACATCCCTCCAG
  • BKK16860 ([gene|9A5EB7CA38D948007AD788297128035AB4074490|ymfH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGTTCATATTCGATTGGTT, downstream forward: _UP4_TAAACAAAACATCCCTCCAG
  • References

  • 18502870