SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative 4-oxalocrotonate tautomerase
14.54 kDa
protein length
129 aa Sequence Blast
gene length
390 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,725,114 2,725,503

    The protein

    Protein family

  • [SW|4-oxalocrotonate tautomerase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|1F6B2CF88F5C6498A035FA0465136EF9D0BF93BC|YodA]
  • Structure

  • [PDB|2AAG] (from Pseudomonas pavonaceae 54% identity)
  • Biological materials


  • MGNA-A862 (yrdN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE26660 ([gene|9A56CC9B3C33D74A7349112930ADF627099DA907|yrdN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCCCCTCCTTCTA, downstream forward: _UP4_TAGTTGAATACTACCCTCAA
  • BKK26660 ([gene|9A56CC9B3C33D74A7349112930ADF627099DA907|yrdN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCCCCTCCTTCTA, downstream forward: _UP4_TAGTTGAATACTACCCTCAA