SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


K+/H+ antiporter for K+ efflux
43.79 kDa
protein length
405 aa Sequence Blast
gene length
1218 bp Sequence Blast
potassium ion efflux
K+/H+ antiporter for K+ efflux

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Potassium uptake/ export]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,059,203 1,060,420

    Phenotypes of a mutant

  • increased sensitivity to methylglyoxal [Pubmed|24330391]
  • The protein

    Protein family

  • Monovalent cation:proton antiporter 2 (CPA2) transporter (TC 2.A.37) family (with [protein|6985ED02AC7A04D4FD5E531C47DD4D1711D7F829|CpaA], according to UniProt)
  • Structure

  • [PDB|4BWZ] (sodium proton antiporter NapA from Thermus thermophilus, 26% identity) [pubmed|23995679]
  • [SW|Localization]

  • cell membrane, integral membrane protein (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A682 (yhaU::erm), available at the [ NBRP B. subtilis, Japan]
  • GP2078 ([gene|A54E8E38AEF596D09B4BEB64D9F539A8AD34E73D|khtS]-[gene|D8A8FBC05B9665F72A88685D2B33822C2BB84C62|khtT]-[gene|9A54C82323BA9220CAA6041E3745FAB9E222FE78|khtU]::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE09850 ([gene|9A54C82323BA9220CAA6041E3745FAB9E222FE78|khtU]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATACAAGATGGTCCATCG, downstream forward: _UP4_GGATAAAAAAAGCAGCACTG
  • BKK09850 ([gene|9A54C82323BA9220CAA6041E3745FAB9E222FE78|khtU]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAATACAAGATGGTCCATCG, downstream forward: _UP4_GGATAAAAAAAGCAGCACTG
  • FLAG-tag construct

  • GP2432 ''khtU-3xFLAG spc'' (based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 27935846
  • Original publications

  • 24330391,14987767,17679694,22383849,23995679