SubtiBank SubtiBank
ykkE [2018-02-09T19:46:24.000Z]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykkE [2018-02-09T19:46:24.000Z]

formyltetrahydrofolate deformylase
locus
BSU13110
pI
5.95
mw
34.34 kDa
protein length
300 aa Sequence Blast
gene length
900 bp Sequence Blast
function
purine nucleotide synthesis
product
formyltetrahydrofolate deformylase
essential
no
ec
3.5.1.10
synonyms
purU

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    1,377,243 → 1,378,145

    The protein

    Catalyzed reaction/ biological activity

  • 10-formyltetrahydrofolate + H2O = formate + tetrahydrofolate (according to Swiss-Prot)
  • Protein family

  • ACT domain (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|7B30F27D6C459437967A64467E52961F4A9E0F2C|PurN]
  • Structure

  • [PDB|3W7B] (from ''Thermus thermophilus'', 58% identity) [Pubmed|24108189]
  • Expression and Regulation

    Operons

    genes
    [gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B310 (ykkE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1309 NBRP B. subtilis, Japan]
  • BKE13110 (Δ[gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC, downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG
  • BKK13110 (Δ[gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC, downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG
  • References

  • 24108189,22383849