SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


formyltetrahydrofolate deformylase
34.34 kDa
protein length
300 aa Sequence Blast
gene length
903 bp Sequence Blast
purine nucleotide synthesis
formyltetrahydrofolate deformylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    1,377,243 1,378,145

    The protein

    Catalyzed reaction/ biological activity

  • 10-formyltetrahydrofolate + H2O = formate + tetrahydrofolate (according to Swiss-Prot)
  • Protein family

  • ACT domain (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|7B30F27D6C459437967A64467E52961F4A9E0F2C|PurN]
  • [SW|Domains]

  • [SW|ACT domain] (aa 21 ... 102) (according to the Interpro database)
  • Structure

  • [PDB|3W7B] (from ''Thermus thermophilus'', 58% identity) [Pubmed|24108189]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B310 (ykkE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13110 ([gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC, downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG
  • BKK13110 ([gene|9A399CAA672C3DF90531A7A7168916DE86EFA365|ykkE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATAATCCCTCTTATC, downstream forward: _UP4_TAGACTGCAAGAGGCCCGCG
  • References

  • 24108189,22383849