SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


LD-carboxypeptidase, releases D-Ala from the cell wall
30.70 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast
cell wall synthesis

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Biosynthesis of peptidoglycan]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW|Biosynthesis of peptidoglycan]
  • Gene

    2,134,566 2,135,387

    The protein

    Catalyzed reaction/ biological activity

  • trimming of cell wall peptides (tetrapeptides to tripeptides) wit concomitant release of D-ala [Pubmed|24909784]
  • Protein family

  • peptidase M15B family (single member, according to UniProt)
  • [SW|Cofactors]

  • Zn2+ [Pubmed|24909784]
  • Structure

  • [PDB|4OX3] [Pubmed|24909784]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B439 (yodJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19620 ([gene|9A22825FD67B6A205807433D0B4908F86E5AB343|ldcB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACATTACCTTCCTT, downstream forward: _UP4_TAAAATGAAAAGCCCGCTTA
  • BKK19620 ([gene|9A22825FD67B6A205807433D0B4908F86E5AB343|ldcB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTACATTACCTTCCTT, downstream forward: _UP4_TAAAATGAAAAGCCCGCTTA
  • References

  • 18957862,24909784,22383849,21378199