SubtiBank SubtiBank
yxaB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxaB

general stress protein, similar to pyruvyl transferase
locus
BSU_40030
pI
4.53
mw
39.61 kDa
protein length
343 aa Sequence Blast
gene length
1032 bp Sequence Blast
function
biofilm formation, survival of salt and ethanol stress
product
putative exopolysaccaride synthase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    4,110,949 4,111,980

    The protein

    Protein family

  • polysaccharide pyruvyl transferase family (with [protein|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|EpsI] and [protein|52A47B49B1FB955EE7E3C316B57A2B4134F78480|EpsO], according to UniProt)
  • Paralogous protein(s)

  • [protein|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|EpsI]
  • Structure

  • [PDB|5AX7] (from yeast, 30% identity) [pubmed|27194449]
  • Expression and Regulation

    Operons

    genes
    [gene|4907D4585491349E2592B0EF9150312A80785EE5|yxaA]-[gene|9A223AE85131511B7EA3A71EA57D87E8B167FA67|yxaB]
    description
    [Pubmed|15805528,10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15805528], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15805528,18326573], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    genes
    [gene|9A223AE85131511B7EA3A71EA57D87E8B167FA67|yxaB]
    description
    [Pubmed|15805528]

    regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B681 (yxaB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1680 NBRP B. subtilis, Japan]
  • BKE40030 ([gene|9A223AE85131511B7EA3A71EA57D87E8B167FA67|yxaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGCGTCCTCCTTCT, downstream forward: _UP4_TAAACGAAAAAGACTGCCCT
  • BKK40030 ([gene|9A223AE85131511B7EA3A71EA57D87E8B167FA67|yxaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGCGTCCTCCTTCT, downstream forward: _UP4_TAAACGAAAAAGACTGCCCT
  • References

  • 10746760,15805528,27194449