SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component sensor kinase/phosphatase, response to bacitracin
40.55 kDa
protein length
360 aa Sequence Blast
gene length
1083 bp Sequence Blast
control of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR] activity in response to bacitracin
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    3,395,035 3,396,117

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]
  • dephosphorylation of [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR] in the absence of the stress signal [Pubmed|23279150]
  • [SW|Domains]

  • two transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • LiaS kinase activity is inhibited by [protein|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|LiaF], phosphatase acitivity is maintained by [protein|C107A958DFA2B0DA4837E2F9F648CD329A3116AC|LiaF] in the absence of the stress signal [Pubmed|23279150]
  • Structure

  • [PDB|3GIG] ([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK], corresponds to the C-terminal domain, aa 149 ... 343, 25% identity) [pubmed|19805278]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15273097], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • regulation

  • ''[protein|search|liaG]'': constitutive
  • view in new tab



  • ''[protein|search|liaG]'': constitutive
  • view in new tab

    Biological materials


  • MGNA-B036 (yvqE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33090 ([gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGGCTGGCAAGCATTTTTT, downstream forward: _UP4_CCGGAAGAAAAAGGAGAGAA
  • BKK33090 ([gene|9A1871BD853254EEA8B4E78CA187F9315CBDF43D|liaS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAGGCTGGCAAGCATTTTTT, downstream forward: _UP4_CCGGAAGAAAAAGGAGAGAA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References


  • 27344142
  • Original publications

  • 18394148,19164152,15273097,17921301,10094672,19164157,14651641,17600057,17660417,16816187,15101989,17660417,20057163,23279150,20817675,22964256,22092710,23326432,27856233,29185696,19805278,30848888