SubtiBank SubtiBank
pelC [2019-06-25 10:27:10]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pelC [2019-06-25 10:27:10]

pectate lyase C
24.13 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
degradation of polygalacturonic acid
pectate lyase C

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,590,603 3,591,268

    The protein

    Catalyzed reaction/ biological activity

  • Eliminative cleavage of (14)-alpha-D-galacturonan to give oligosaccharides with 4-deoxy-alpha-D-galact-4-enuronosyl groups at their non-reducing ends (according to Swiss-Prot)
  • Protein family

  • polysaccharide lyase 3 family (according to Swiss-Prot)
  • Structure

  • [PDB|1EE6] (from Bacillus sp., 58% identity) [pubmed|11717490]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A382 (yvpA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE34950 ([gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGATAAATCCTCCCCGG, downstream forward: _UP4_TTTTAACAAAAAAAGTCCGC
  • BKK34950 ([gene|99ECA1B305145A63BD3A72094EF24F56D875BCC1|pelC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGATAAATCCTCCCCGG, downstream forward: _UP4_TTTTAACAAAAAAAGTCCGC
  • References

  • 18957862,16514142,20525796,24236123,11717490