SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to phage-related protein
7.48 kDa
protein length
gene length
207 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,692,645 2,692,851

    Biological materials


  • BKE26240 ([gene|99C4008F5D74132B4763415AE8B22C69598B41E1|yqaO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCAAAGCGCCCCCTATG, downstream forward: _UP4_TGAGAAGAAGATATAATACT
  • BKK26240 ([gene|99C4008F5D74132B4763415AE8B22C69598B41E1|yqaO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCAAAGCGCCCCCTATG, downstream forward: _UP4_TGAGAAGAAGATATAATACT
  • References

  • 20525796