SubtiBank SubtiBank
mhqR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mhqR

[SW|MarR family ]transcriptional repressor of [gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2], [gene|7334017333600B876030056BE9247AD4E8996A1D|mhqA], [gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]-[gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]and [gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]-[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]-[gene|search|mhqP ]expression
locus
BSU13670
pI
6.42
mw
16.43 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
regulation of resistance to quinones and diamide
product
[SW|MarR family ]transcriptional repressor
essential
no
synonyms
ykvE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,433,199 1,433,636

    Phenotypes of a mutant

  • resistant to quinones and diamide
  • inactivation of ''mhqR'' predisposes cells to grow without a wall (due to protection from oxidative stress) [Pubmed|26051891]
  • The protein

    Paralogous protein(s)

  • [protein|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|YkoM]
  • Structure

  • [PDB|3GFJ] (from Sulfolobus tokodaii, 26% identity) [pubmed|19509310]
  • Additional information

  • Binding site: tATCTcgaAtTCgAGATaaaa [Pubmed|17725564]
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000225 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE13670 ([gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT, downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
  • BKK13670 ([gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT, downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
  • labs

  • [SW|Haike Antelmann],Free University of Berlin, Germany
  • References

  • 18282125,26051891,17725564,22383849,27965289,19509310