SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


[SW|MarR family ]transcriptional repressor of [gene|0E2B1914A040666BAF042C0BE3F468144E1F1E06|azoR2], [gene|7334017333600B876030056BE9247AD4E8996A1D|mhqA], [gene|43CD556065D2EF14365C78E014B7B2051CA0C78F|mhqD]-[gene|A1CB3DCF2EC78B9B0585CA6AC6F5BB37B8AF0208|mhqE]and [gene|A0842DD5F1B13AC15C95F18751E7836DF31B262A|mhqN]-[gene|ACAFB2072E74CC059B492A31EF492028B96C569F|mhqO]-[gene|search|mhqP ]expression
16.43 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
regulation of resistance to quinones and diamide
[SW|MarR family ]transcriptional repressor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    1,433,199 1,433,636

    Phenotypes of a mutant

  • resistant to quinones and diamide
  • inactivation of ''mhqR'' predisposes cells to grow without a wall (due to protection from oxidative stress) [Pubmed|26051891]
  • The protein

    Paralogous protein(s)

  • [protein|A703CA58365926CFE6BFC1C4A0B1DA22C67C85AC|YkoM]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 5-137) (according to UniProt)
  • Structure

  • [PDB|3GFJ] (from Sulfolobus tokodaii, 26% identity) [pubmed|19509310]
  • Additional information

  • Binding site: tATCTcgaAtTCgAGATaaaa [Pubmed|17725564]
  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE13670 ([gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT, downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
  • BKK13670 ([gene|997B828A99D6D8460712C18ED0CE566B285C22DC|mhqR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCAATCATCCTTTT, downstream forward: _UP4_TAAAAAAAGGAAGCCTGATA
  • labs

  • [SW|Haike Antelmann],Free University of Berlin, Germany
  • References

  • 18282125,26051891,17725564,22383849,27965289,19509310