SubtiBank SubtiBank
phrE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

phrE

response regulator aspartate phosphatase (RapE) regulator, control of the phosphorelay
locus
BSU_25840
pI
8.86
mw
4.72 kDa
protein length
gene length
135 bp Sequence Blast
function
control of sporulation initiation
product
phosphatase (RapE) regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.3|Control of response regulators/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.6|Other protein controlling the activity of the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.6|Other protein controlling the activity of the phosphorelay]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    Coordinates
    2,660,330 2,660,464

    The protein

    Protein family

  • [SW|phr family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]
    description
    [Pubmed|11466295]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11466295], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|11466295], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • repressed by glucose (10-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    genes
    [gene|8B8646DF7F437D8DB299A77BA937DC6FC082102F|rapE]-[gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]
    description
    [Pubmed|11466295,10629174]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • repressed by glucose (10-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE25840 ([gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGGCGGATAAACTGATAA, downstream forward: _UP4_TAATTCGATAAACAACATTA
  • BKK25840 ([gene|997434F9679B3A2F8D2453D0C3BAB24F5BB90922|phrE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGGCGGATAAACTGATAA, downstream forward: _UP4_TAATTCGATAAACAACATTA
  • References

  • 12618455,12850135,11466295,10629174,21821766,20817675