SubtiBank SubtiBank
yvgN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvgN

glyoxal reductase, general stress protein
locus
BSU_33400
pI
5.07
mw
31.51 kDa
protein length
276 aa Sequence Blast
gene length
831 bp Sequence Blast
function
unknown
product
glyoxal reductase
essential
no
ec
1.1.1.283
synonyms
yvsB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,426,749 3,427,579

    The protein

    Catalyzed reaction/ biological activity

  • Lactaldehyde + NADP+ --> methylglyoxal + NADPH (according to UniProt)
  • Protein family

  • [SW|Aldo/keto reductase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|DE12190315DADF13DA1BA272924729BBF909B1D9|YtbE]
  • [SW|Cofactors]

  • NADP+ [pubmed|31165224]
  • Structure

  • [PDB|3B3E] [Pubmed|19585557]
  • Expression and Regulation

    Operons

    genes
    [gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B061 (yvgN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1060 NBRP B. subtilis, Japan]
  • BKE33400 ([gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCTCCACCCTTT, downstream forward: _UP4_TAATCAAAAAACTCCCCGTT
  • BKK33400 ([gene|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|yvgN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTGAACCTCCACCCTTT, downstream forward: _UP4_TAATCAAAAAACTCCCCGTT
  • References

  • 16232966,16430695,19585557,15805528,31165224