SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


aminotransferase involved in bacilysin synthesis
44.54 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
biosynthesis of the antibiotic bacilysin

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    3,868,287 3,869,486

    The protein

    Catalyzed reaction/ biological activity

  • YwfG catalyzes transamination of tetrahydro-4-hydroxyphenylpyruvate (with L-Phe as amino donor), to form tetrahydrotyrosine [Pubmed|20052993]
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|938E08D2C50649A52EC06B9A08C6A73598E68CE1|MtnE]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|2O1B] (from Staphylococcus aureus, 40% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials


  • MGNA-A514 (ywfG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37690 ([gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACATCGGACGGTGTTATTT, downstream forward: _UP4_TCCCGCTAAAAAGCGGGATG
  • BKK37690 ([gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACATCGGACGGTGTTATTT, downstream forward: _UP4_TCCCGCTAAAAAGCGGGATG
  • References

  • 12372825,19801406,20052993,21948839,12697329,21709425