SubtiBank SubtiBank
bacF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bacF

aminotransferase involved in bacilysin synthesis
locus
BSU37690
pI
5.35
mw
44.54 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
function
biosynthesis of the antibiotic bacilysin
product
aminotransferase
essential
no
ec
2.6.1.1
synonyms
ywfG,ipa-85d

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    3,868,287 3,869,486

    The protein

    Catalyzed reaction/ biological activity

  • YwfG catalyzes transamination of tetrahydro-4-hydroxyphenylpyruvate (with L-Phe as amino donor), to form tetrahydrotyrosine [Pubmed|20052993]
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|938E08D2C50649A52EC06B9A08C6A73598E68CE1|MtnE]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|2O1B] (from Staphylococcus aureus, 40% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|3F49F4AEFC49C2883EFA60FEB3E77591F184195B|bacA]-[gene|0EEE23875DB720D256D53F00D1AD5EF24B538B27|bacB]-[gene|20A7DBA142F3BF8DCAD9732BD908CE8CC79AA993|bacC]-[gene|2CE0C0484A70EEE40277996CD3D564A84FEAF5B3|bacD]-[gene|4D2AD84E74888EC61E44DE5B8E31812F43250B05|bacE]-[gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]
    description
    [Pubmed|12372825]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|19801406], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12372825,21709425], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|12697329,21709425], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19801406], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A514 (ywfG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/514 NBRP B. subtilis, Japan]
  • BKE37690 ([gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACATCGGACGGTGTTATTT, downstream forward: _UP4_TCCCGCTAAAAAGCGGGATG
  • BKK37690 ([gene|99434727013FCCD6E570AE550560A8546F7F2A41|bacF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACATCGGACGGTGTTATTT, downstream forward: _UP4_TCCCGCTAAAAAGCGGGATG
  • References

  • 12372825,19801406,20052993,21948839,12697329,21709425