SubtiBank SubtiBank
pucB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pucB

xanthine dehydrogenase
locus
BSU_32500
pI
7.92
mw
20.91 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
purine utilization
product
xanthine dehydrogenase
essential
no
synonyms
yurE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    3,339,331 3,339,948

    The protein

    Structure

  • [PDB|2WAW] (from Mycobacterium tuberculosis, 27% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|C9370B221117B89A1134B413748D39505C2E1DA8|pucA]-[gene|99428BD0B1A8E91F4B028ACF8AB51B235DDB4F11|pucB]-[gene|D0F00ACF5AAD9E9418033F5B47527C4D50007F18|pucC]-[gene|B65E4B340961332ED0ACC7FD957351256F708F60|pucD]-[gene|6855CC156FCB4C4A16AFD6ADE18F3FFC82B61843|pucE]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (effector: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A941 (yurE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/941 NBRP B. subtilis, Japan]
  • BKE32500 ([gene|99428BD0B1A8E91F4B028ACF8AB51B235DDB4F11|pucB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATACAACCGCCACCCG, downstream forward: _UP4_TCTTGAACGGCCAAGTGACA
  • BKK32500 ([gene|99428BD0B1A8E91F4B028ACF8AB51B235DDB4F11|pucB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATACAACCGCCACCCG, downstream forward: _UP4_TCTTGAACGGCCAAGTGACA
  • References

  • 11344136,12029039,12823818