SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


xanthine dehydrogenase
20.91 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
purine utilization
xanthine dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    3,339,331 3,339,948

    The protein


  • [PDB|2WAW] (from Mycobacterium tuberculosis, 27% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (effector: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials


  • MGNA-A941 (yurE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32500 ([gene|99428BD0B1A8E91F4B028ACF8AB51B235DDB4F11|pucB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATACAACCGCCACCCG, downstream forward: _UP4_TCTTGAACGGCCAAGTGACA
  • BKK32500 ([gene|99428BD0B1A8E91F4B028ACF8AB51B235DDB4F11|pucB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTCATACAACCGCCACCCG, downstream forward: _UP4_TCTTGAACGGCCAAGTGACA
  • References

  • 11344136,12029039,12823818