SubtiBank SubtiBank
bsaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bsaA

similar to glutathione peroxidase
locus
BSU21900
pI
5.25
mw
18.11 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,304,553 2,305,035

    The protein

    Structure

  • [PDB|2WGR] (Schistosoma mansoni phospholipid glutathione peroxidase, 49% identity) [pubmed|19714775]
  • Additional information

  • The gene is annotated in KEGG as glutathione peroxidase EC 1.11.1.9. It is marked in Swiss-Prot as glutathione peroxidase homolog and in MetaCyc as glutathione peroxidase. Several studies suggested that glutathione is probably absent in ''B. subtilis''. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]-[gene|A0CC440185318F7F8665AF7A8279C79A09E35518|ypgQ]-[gene|B42367583867799BD88D737C848E16B9143C5957|ypgR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A887 (bsaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/887 NBRP B. subtilis, Japan]
  • BKE21900 ([gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGTCCCTCCTATGT, downstream forward: _UP4_GAGCAATAAAAAGAGGGTGT
  • BKK21900 ([gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGTCCCTCCTATGT, downstream forward: _UP4_GAGCAATAAAAAGAGGGTGT
  • References

  • 8969496,19935659,19714775